MicroRNA Mouse Mus musculus

mmu-miR-484-3p

The 3p arm of the hairpin mmu-mir-484 (MI0003491); the other arm is mmu-miR-484-5p.

Sequence of mmu-miR-484-3p: ACCUAGGGGG CUGGCGGCGU A

21 nt, as miRBase release 23 writes it, 5' to 3'; unchanged in miRBase release 23.

Human: the votes name MIR484, and miRBase's file lists no mature of the 3p arm under it.
Rat: no vote names an ortholog of Mir484: the Alliance, NCBI and Ensembl Compara answered and named none; RGD did not answer (upstream error, reference 0ecc73c2-502).

Gene placement: NCBI: 16:13,977,490-13,977,556 on the plus strand, GRCm39 (GCF_000001635.27), sequence NC_000082.7, annotation GCF_000001635.27-RS_2024_02Ensembl: 16:13,977,490-13,977,556 on the plus strand, GRCm39 (GCA_000001635.9), Ensembl release 116
Host gene: Lies within Gm60486, on the same strand; Lies within Marf1, on the opposite strand (Ensembl release 116, GRCm39).
The gene is also known as: Mirn484, mir-484, mmu-mir-484 (names of the gene Mir484, as NCBI Datasets 18.38.0 lists them)

miRBase placement: The mature: 16:13,977,536-13,977,556 on the plus strand, GRCm39 (GCA_000001635.9)The hairpin mmu-mir-484: 16:13,977,490-13,977,556 on the plus strand, GRCm39 (GCA_000001635.9)Coordinates are one-based with both ends included, as each source reports them.

MicroRNA identity, from miRBase · miRBase v23 (2026-07-29), GRCm39 · read 2026-10-02 ET · miRBase MIMAT0050681miRBase release 23; Kozomara A, Birgaoanu M, Griffiths-Jones S. Nucleic Acids Research (2019).

Inhibit or mimic this microRNA

The order page opens with mmu-miR-484-3p and mouse filled in; the price is on that page.

Order for mmu-miR-484-3p

AUMantagomir sdASO to inhibit or AUMmimic sdASO to replace, chosen on the next page

Bring your own sequence The hairpin's gene page

For research use only. Not for use in diagnostic or therapeutic procedures.

Sequence and arms
The gene and its locus
In other species
Cross-references
Pathways
Targets
Literature
AUM BioTech's studies
Inhibit or mimic this microRNA

A line below that says it is reading needs JavaScript to be replaced: with scripts off, it stays at that line however long you wait. Opening a card also needs JavaScript.

Ready in a moment

01 Sequence and arms

The mature, its arm and its hairpin

mmu-miR-484-3p is 21 nt, the 3p arm of the 67 nt hairpin mmu-mir-484; the other arm is mmu-miR-484-5p. Its sequence did not change in miRBase release 23.

miRBase

Ready in a moment

What this tells you

miRBase's files name this mature, its accession, its sequence and the hairpin it derives from, and the GFF3 places both on the genome. Of the hairpins the GFF3's header says: “Note, these sequences do not represent the full primary transcript, rather a predicted stem-loop portion that includes the precursor miRNA.”

A sentence from RefSeq's summary on the gene, as NCBI Gene carries it: “The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products.” [RefSeq, Sep 2009].

The arm suffix is miRBase's naming. The README of release 23 says: “20514 mature sequences have had their names clarified, usually upon the addition of a 2nd mature product from the same locus. For example, hsa-miR-107 is renamed to hsa-miR-107-3p on the addition of hsa-miR-107-5p to the database.” The convention that mir names a hairpin and miR a mature is the annotation guidelines paper the README cites: Ambros V, Bartel B, Bartel DP, Burge CB, Carrington JC, Chen X, Dreyfuss G, Eddy SR, Griffiths-Jones S, Marshall M, Matzke M, Ruvkun G, Tuschl T. A uniform system for microRNA annotation. RNA 2003 9(3):277-279. PubMed 12592000, DOI 10.1261/rna.2183803. miRBase itself is cited as the credit line carries it: Kozomara A, Birgaoanu M, Griffiths-Jones S. miRBase: from microRNA sequences to function. Nucleic Acids Res 2019 47(D1):D155-D162. PubMed 30423142, DOI 10.1093/nar/gky1141.

The seed drawn on the mature is a cited definition, not a measurement. MirGeneDB's information page (read 2026-09-08) says: “Nucleotide positions 2 through 8 of the mature sequence (the "seed") are strongly conserved through evolution, as are positions 13-16 (the 3' complementary region) (13,20,21).” TargetScan's FAQ defines its site types by the same positions counted two ways: “7mer-m8: An exact match to positions 2-8 of the mature miRNA (the seed + position 8)” and “7mer-1A: An exact match to positions 2-7 of the mature miRNA” followed by an A. So TargetScan's seed proper is positions 2 to 7, and the span this page shades, 2 to 8, is MirGeneDB's.

The two arms are different microRNAs, so an antagomir or a mimic is made against one of them; the other arm has its own page, and the order door of this page carries this arm's name.

The mature sequence

Positions 1 to 21 of mmu-miR-484-3p, 5' to 3', as MirGeneDB's definition counts them. The shaded positions 2 to 8 are the seed region, nucleotides 2 to 8, as MirGeneDB's information page defines it (read 2026-09-08); nothing else on the sequence is marked.

The records of mmu-miR-484-3p as text
Mature name	mmu-miR-484-3p
Accession	MIMAT0050681
Sequence, 5' to 3'	ACCUAGGGGGCUGGCGGCGUA
Length	21 nt, as miRBase release 23 writes it
Seed, positions 2 to 8	CCUAGGG
Changed in this release	no: the diff of miRBase release 23 carries no SEQUENCE line for MIMAT0050681
Placement	16:13,977,536-13,977,556 on the plus strand, GRCm39 (GCA_000001635.9)

The hairpin mmu-mir-484 MI0003491 67 nt

The hairpin mmu-mir-484 drawn as a line, 5' to 3': each mature at the positions the records give it, the bases between two matures labelled the loop, and the bases before and after them the flanks. No fold is drawn: the shape of the hairpin is not in any file this page reads.

The segments of mmu-mir-484 as text
Segment	Positions	Length	Bases, 5' to 3'
5' flank	1-4	4 nt	CUCG

The hairpin and the matures are written as RNA, with U, as miRBase's files write them; the genomic and RefSeq records of the same span are written as DNA, with T. miRBase's entry page for MIMAT0050681 carries an Evidence line that no downloadable file carries, so it is not on this page; read it there.

Mature and hairpin sequences and spans, from miRBase · miRBase v23 (2026-07-29), GRCm39 · read 2026-10-02 ET · miRBase MIMAT0050681miRBase release 23; Kozomara A, Birgaoanu M, Griffiths-Jones S. Nucleic Acids Research (2019).
Seed definition, from MirGeneDB · MirGeneDB information page, read 2026-09-08 · MirGeneDB information

Reading miRBase.Still reading. A first read of a microRNA can take a while; this page waits up to 5 seconds for it, and its scripts then bring in the panel, or a line saying what did not arrive.

02 The gene and its locus

The gene of mmu-mir-484 and where it sits

Mir484 (MGI:3619421), 16 A1, within Gm60486 on the same strand and within Marf1 on the opposite strand. RefSeq NR_030252.1, 67 nt.

NCBI Gene · MGI · Ensembl

Ready in a moment

What this tells you

The hairpin is a gene to the nomenclature authorities and to NCBI Gene and Ensembl: HGNC for human, MGI for mouse and RGD for rat name it, NCBI places it on the reference annotation and RefSeq holds its stem-loop record, and Ensembl places it and says what other gene its span lies inside. Each placement is on the assembly its source names, and the card never converts one into another.

A sentence from RefSeq's summary on the gene, as NCBI Gene carries it: “miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding.” [RefSeq, Sep 2009].

The gene page holds the locus's own records: the transcripts, the variants and the disease associations are the gene's, and this card links to it rather than repeating them as if they were this arm's.

The gene Mir484 of the hairpin mmu-mir-484

Symbol

Mir484 microRNA 484

Type

non-coding RNA ncRNA

MGI

MGI:3619421

NCBI Gene

723916

Ensembl

ENSMUSG00000070074.3

RefSeq records

NR_030252.1 67 nt, the length of the hairpin in miRBase release 23 non-coding (NON_CODING) Ensembl ENSMUST00000093566.3
Annotation GCF_000001635.27-RS_2024_02.

Cytogenetic band

16 A1

Also known as

Mirn484, mir-484, mmu-mir-484

RefSeq's summary on the gene Mir484, as NCBI Gene carries it, quoted as written.

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop.
[provided by RefSeq, Sep 2009]

Placements, each on the assembly its source names

miRBase, the hairpin mmu-mir-484: 16:13,977,490-13,977,556 on the plus strand, GRCm39 (GCA_000001635.9)
NCBI, the gene: 16:13,977,490-13,977,556 on the plus strand, GRCm39 (GCF_000001635.27), sequence NC_000082.7, annotation GCF_000001635.27-RS_2024_02
Ensembl, the gene: 16:13,977,490-13,977,556 on the plus strand, GRCm39 (GCA_000001635.9), Ensembl release 116

Coordinates are one-based with both ends included, as each source reports them.

The host gene of Mir484, from Ensembl's overlap

Gm60486 ENSMUSG00000132903.1lncRNA

predicted gene, 60486 (Ensembl credits MGI Symbol, Acc:MGI:7804023)

16:13,977,162-13,978,745 on the plus strand, GRCm39 (GCA_000001635.9); Mir484 lies within the span of Gm60486; sense, on the same strand as Gm60486.

Marf1 ENSMUSG00000060657.10protein_coding

meiosis regulator and mRNA stability 1 (Ensembl credits MGI Symbol, Acc:MGI:2444505)

16:13,927,030-13,981,215 on the minus strand, GRCm39 (GCA_000001635.9); Mir484 lies within the span of Marf1; antisense, on the opposite strand to Marf1.

Ensembl release 116, GRCm39 (GCA_000001635.9): the overlap is by span, over every biotype, and says nothing about the two being one transcript. The hairpin mmu-mir-484 is placed by miRBase on its own build, above.

The Mir484 gene pageThe locus's own records, the transcripts, the variants and the disease associations, are the gene's and are on that page.

Gene record and placements, from MGI, NCBI Gene and Ensembl · miRBase v23 (2026-07-29); NCBI Datasets 18.38.0 · read 2026-10-02 ET · NCBI Gene 723916Data from NCBI, provided as is; NCBI's policies and disclaimers apply.
Hairpin and mature placements, from miRBase · miRBase v23 (2026-07-29), GRCm39 · read 2026-10-02 ET · miRBase MI0003491miRBase release 23; Kozomara A, Birgaoanu M, Griffiths-Jones S. Nucleic Acids Research (2019).
Host gene of Mir484, from Ensembl's overlap · Ensembl 116 · read 2026-10-01 ET · Ensembl ENSMUSG00000132903Ensembl release 116, GRCm39 (GCA_000001635.9)
RefSeq records of Mir484, from NCBI Datasets · NCBI Datasets 18.38.0; GCF_000001635.27-RS_2024_02 · read 2026-10-01 ET · NR_030252.1NCBI Datasets 18.38.0; annotation GCF_000001635.27-RS_2024_02 (public domain)

Reading NCBI Gene, the nomenclature authority and Ensembl.Still reading. A first read of a microRNA can take a while; this page waits up to 90 seconds for it, and its scripts then bring in the panel, or a line saying what did not arrive.

03 In other species

The same arm in mouse, rat and human

Human: MIR484 (by the Alliance and Ensembl Compara) with no mature of the same arm; rat: no vote names an ortholog (the Alliance, NCBI and Ensembl Compara answered and named none; RGD did not answer (upstream error, reference 0ecc73c2-502)).

Alliance · NCBI · Ensembl Compara · miRBase

Ready in a moment

04 Cross-references

The sequence at RNAcentral and its member databases

RNAcentral lists no sequence under MIMAT0050681.

Ready in a moment

05 Pathways

Where Reactome places mmu-miR-484-3p

Reactome v97 maps no pathway to mmu-miR-484-3p (MIMAT0050681) or to mmu-mir-484 (MI0003491) in mouse.

Reactome

Ready in a moment

06 Targets

Where the target databases are

Predicted and validated targets are held by databases whose terms do not grant display on a company's website; 5 doors open them for mmu-miR-484-3p.

Ready in a moment

07 Literature

Papers that mention mmu-miR-484-3p or its base name miR-484

2,477 PubMed-indexed papers match the query for mmu-miR-484-3p or its base name miR-484 at Europe PMC, 25 a page.

Europe PMC

Ready in a moment

08 AUM BioTech's studies on this microRNA

AUM BioTech's published work on mmu-miR-484-3p

No checked AUM BioTech record names mmu-miR-484-3p in mouse.

Ready in a moment

09 Inhibit or mimic this microRNA

Targeting mmu-miR-484-3p

The order page opens with mmu-miR-484-3p and mouse filled in, with AUMantagomir sdASO and AUMmimic sdASO side by side and the price on that page. Five decisions are yours before it does. What is written under each is AUM's guidance; the timings and the concentrations are in the usage guide below.

01
Choose the arm
The mature named on this page is one arm of its hairpin; the other arm, mmu-miR-484-5p, is a different microRNA with its own page. An inhibitor or a mimic is made against one arm, and the order door of this page carries mmu-miR-484-3p.
02
Inhibit or replace
An AUMantagomir sdASO inhibits the mature microRNA; an AUMmimic sdASO supplies one. Both are self-delivering. AUMantagomir toASO is the transfection-optimised version of AUMantagomir sdASO, a lower-cost option that needs a transfection reagent.
03
Check the species
The sequence is mouse's, as miRBase release 23 writes it. Where the orthologs card shows the same arm in another species with another sequence, a design for one species is not a design for the other; where the bases are the same, that is a sequence fact the card states, not a claim about the two.
04
Run the controls
A scramble control of the same chemistry, the positive control the order page offers for the product, untreated cells, and a mock condition wherever a transfection reagent is used. The order page lists the controls beside the product.
05
Read the result at the target level
Inhibiting or supplying a microRNA is read in what it acts on, not in the microRNA alone: the transcripts and the proteins your own experiment names as its targets. The usage guide gives the timing and the concentrations to start from; nothing on this page names a target.

Order for mmu-miR-484-3p Bring your own sequence The usage guide

AUMantagomir sdASO to inhibit or AUMmimic sdASO to replace, chosen on the next page

For research use only. Not for use in diagnostic or therapeutic procedures.

mmu-miR-484-3p

The mature, its arm and its hairpin

The mature sequence

The hairpin mmu-mir-484 MI0003491 67 nt

The gene of mmu-mir-484 and where it sits

The gene Mir484 of the hairpin mmu-mir-484

Placements, each on the assembly its source names

The host gene of Mir484, from Ensembl's overlap

The same arm in mouse, rat and human

The sequence at RNAcentral and its member databases

Where Reactome places mmu-miR-484-3p

Where the target databases are

Papers that mention mmu-miR-484-3p or its base name miR-484

AUM BioTech's published work on mmu-miR-484-3p

Targeting mmu-miR-484-3p

Choose the arm

Inhibit or replace

Check the species

Run the controls

Read the result at the target level

The gene Mir484 of the hairpin mmu-mir-484

Placements, each on the assembly its source names

The host gene of Mir484, from Ensembl's overlap

The mature sequence

The hairpin mmu-mir-484 MI0003491 67 nt