MicroRNA Rat Rattus norvegicus

rno-miR-24-2-5p

The 5p arm of the hairpin rno-mir-24-2 (MI0000855); the other arm is rno-miR-24-3p.

Sequence of rno-miR-24-2-5p: GUGCCUACUG AGCUGAAACA GU

22 nt, as miRBase release 23 writes it, 5' to 3'; unchanged in miRBase release 23.

Mouse: no vote names an ortholog of Mir24-2: the Alliance and NCBI answered and named none; Ensembl Compara: no Ensembl gene id is known for Mir24-2, so Compara was not asked; RGD did not answer (upstream error, reference d9a5faa9-28d).

Gene placement: NCBI: 19:40,859,455-40,859,562 on the minus strand, GRCr8 (GCF_036323735.1), sequence NC_086037.1, annotation GCF_036323735.1-RS_2026_08Ensembl: no gene placement in this record; the host gene line below says why.miRBase release 23 places rno-mir-24-2 on Rnor_6.0; NCBI's annotation GCF_036323735.1-RS_2026_08 places the gene Mir24-2 on GRCr8. The two are different assemblies and are not compared here.
Host gene: Ensembl names no rat gene Mir24-2: Ensembl has no rat record for that identifier
The gene is also known as: rno-mir-24-2 (names of the gene Mir24-2, as NCBI Datasets 18.38.0 lists them)

miRBase placement: The mature: 19:25,318,887-25,318,908 on the plus strand, Rnor_6.0 (GCA_000001895.4)The hairpin rno-mir-24-2: 19:25,318,863-25,318,970 on the plus strand, Rnor_6.0 (GCA_000001895.4)Coordinates are one-based with both ends included, as each source reports them.

MicroRNA identity, from miRBase · miRBase v23 (2026-07-29), Rnor_6.0 · read 2026-10-02 ET · miRBase MIMAT0005441miRBase release 23; Kozomara A, Birgaoanu M, Griffiths-Jones S. Nucleic Acids Research (2019).

Inhibit or mimic this microRNA

The order page opens with rno-miR-24-2-5p and rat filled in; the price is on that page.

Order for rno-miR-24-2-5p

AUMantagomir sdASO to inhibit or AUMmimic sdASO to replace, chosen on the next page

Bring your own sequence The hairpin's gene page

For research use only. Not for use in diagnostic or therapeutic procedures.

Sequence and arms
The gene and its locus
In other species
Cross-references
Pathways
Targets
Literature
AUM BioTech's studies
Inhibit or mimic this microRNA

A line below that says it is reading needs JavaScript to be replaced: with scripts off, it stays at that line however long you wait. Opening a card also needs JavaScript.

Ready in a moment

01 Sequence and arms

The mature, its arm and its hairpin

rno-miR-24-2-5p is 22 nt, the 5p arm of the 108 nt hairpin rno-mir-24-2; the other arm is rno-miR-24-3p. Its sequence did not change in miRBase release 23.

miRBase

Ready in a moment

What this tells you

miRBase's files name this mature, its accession, its sequence and the hairpin it derives from, and the GFF3 places both on the genome. Of the hairpins the GFF3's header says: “Note, these sequences do not represent the full primary transcript, rather a predicted stem-loop portion that includes the precursor miRNA.”

A sentence from RefSeq's summary on the gene, as NCBI Gene carries it: “The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products.” [RefSeq, Sep 2009].

The arm suffix is miRBase's naming. The README of release 23 says: “20514 mature sequences have had their names clarified, usually upon the addition of a 2nd mature product from the same locus. For example, hsa-miR-107 is renamed to hsa-miR-107-3p on the addition of hsa-miR-107-5p to the database.” The convention that mir names a hairpin and miR a mature is the annotation guidelines paper the README cites: Ambros V, Bartel B, Bartel DP, Burge CB, Carrington JC, Chen X, Dreyfuss G, Eddy SR, Griffiths-Jones S, Marshall M, Matzke M, Ruvkun G, Tuschl T. A uniform system for microRNA annotation. RNA 2003 9(3):277-279. PubMed 12592000, DOI 10.1261/rna.2183803. miRBase itself is cited as the credit line carries it: Kozomara A, Birgaoanu M, Griffiths-Jones S. miRBase: from microRNA sequences to function. Nucleic Acids Res 2019 47(D1):D155-D162. PubMed 30423142, DOI 10.1093/nar/gky1141.

The seed drawn on the mature is a cited definition, not a measurement. MirGeneDB's information page (read 2026-09-08) says: “Nucleotide positions 2 through 8 of the mature sequence (the "seed") are strongly conserved through evolution, as are positions 13-16 (the 3' complementary region) (13,20,21).” TargetScan's FAQ defines its site types by the same positions counted two ways: “7mer-m8: An exact match to positions 2-8 of the mature miRNA (the seed + position 8)” and “7mer-1A: An exact match to positions 2-7 of the mature miRNA” followed by an A. So TargetScan's seed proper is positions 2 to 7, and the span this page shades, 2 to 8, is MirGeneDB's.

The two arms are different microRNAs, so an antagomir or a mimic is made against one of them; the other arm has its own page, and the order door of this page carries this arm's name.

The mature sequence

Positions 1 to 22 of rno-miR-24-2-5p, 5' to 3', as MirGeneDB's definition counts them. The shaded positions 2 to 8 are the seed region, nucleotides 2 to 8, as MirGeneDB's information page defines it (read 2026-09-08); nothing else on the sequence is marked.

The records of rno-miR-24-2-5p as text
Mature name	rno-miR-24-2-5p
Accession	MIMAT0005441
Sequence, 5' to 3'	GUGCCUACUGAGCUGAAACAGU
Length	22 nt, as miRBase release 23 writes it
Seed, positions 2 to 8	UGCCUAC
Changed in this release	no: the diff of miRBase release 23 carries no SEQUENCE line for MIMAT0005441
Placement	19:25,318,887-25,318,908 on the plus strand, Rnor_6.0 (GCA_000001895.4)

The hairpin rno-mir-24-2 MI0000855 108 nt

The hairpin rno-mir-24-2 drawn as a line, 5' to 3': each mature at the positions the records give it, the bases between two matures labelled the loop, and the bases before and after them the flanks. No fold is drawn: the shape of the hairpin is not in any file this page reads.

The segments of rno-mir-24-2 as text
Segment	Positions	Length	Bases, 5' to 3'
5' flank

The hairpin and the matures are written as RNA, with U, as miRBase's files write them; the genomic and RefSeq records of the same span are written as DNA, with T. miRBase's entry page for MIMAT0005441 carries an Evidence line that no downloadable file carries, so it is not on this page; read it there.

Mature and hairpin sequences and spans, from miRBase · miRBase v23 (2026-07-29), Rnor_6.0 · read 2026-10-02 ET · miRBase MIMAT0005441miRBase release 23; Kozomara A, Birgaoanu M, Griffiths-Jones S. Nucleic Acids Research (2019).
Seed definition, from MirGeneDB · MirGeneDB information page, read 2026-09-08 · MirGeneDB information

Reading miRBase.Still reading. A first read of a microRNA can take a while; this page waits up to 5 seconds for it, and its scripts then bring in the panel, or a line saying what did not arrive.

02 The gene and its locus

The gene of rno-mir-24-2 and where it sits

Mir24-2 (RGD:2325349), 19q11, Ensembl names no rat gene Mir24-2; NCBI places the gene on GRCr8. RefSeq NR_031828.1, 108 nt.

NCBI Gene · RGD

Ready in a moment

What this tells you

The hairpin is a gene to the nomenclature authorities and to NCBI Gene and Ensembl: HGNC for human, MGI for mouse and RGD for rat name it, NCBI places it on the reference annotation and RefSeq holds its stem-loop record, and Ensembl places it and says what other gene its span lies inside. Each placement is on the assembly its source names, and the card never converts one into another.

A sentence from RefSeq's summary on the gene, as NCBI Gene carries it: “miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding.” [RefSeq, Sep 2009].

The gene page holds the locus's own records: the transcripts, the variants and the disease associations are the gene's, and this card links to it rather than repeating them as if they were this arm's.

The gene Mir24-2 of the hairpin rno-mir-24-2

Symbol

Mir24-2 microRNA 24-2

Type

non-coding RNA ncRNA

RGD

RGD:2325349

NCBI Gene

100314278

Ensembl

no Ensembl gene id is carried for this gene

RefSeq records

NR_031828.1 108 nt, the length of the hairpin in miRBase release 23 non-coding (NON_CODING)
Annotation GCF_036323735.1-RS_2026_08.

Cytogenetic band

19q11

Also known as

rno-mir-24-2

RefSeq's summary on the gene Mir24-2, as NCBI Gene carries it, quoted as written.

microRNAs (miRNAs) are short (20-24 nt) non-coding RNAs that are involved in post-transcriptional regulation of gene expression in multicellular organisms by affecting both the stability and translation of mRNAs. miRNAs are transcribed by RNA polymerase II as part of capped and polyadenylated primary transcripts (pri-miRNAs) that can be either protein-coding or non-coding. The primary transcript is cleaved by the Drosha ribonuclease III enzyme to produce an approximately 70-nt stem-loop precursor miRNA (pre-miRNA), which is further cleaved by the cytoplasmic Dicer ribonuclease to generate the mature miRNA and antisense miRNA star (miRNA*) products. The mature miRNA is incorporated into a RNA-induced silencing complex (RISC), which recognizes target mRNAs through imperfect base pairing with the miRNA and most commonly results in translational inhibition or destabilization of the target mRNA. The RefSeq represents the predicted microRNA stem-loop.
[provided by RefSeq, Sep 2009]

Placements, each on the assembly its source names

miRBase, the hairpin rno-mir-24-2: 19:25,318,863-25,318,970 on the plus strand, Rnor_6.0 (GCA_000001895.4)
NCBI, the gene: 19:40,859,455-40,859,562 on the minus strand, GRCr8 (GCF_036323735.1), sequence NC_086037.1, annotation GCF_036323735.1-RS_2026_08
Ensembl, the gene: no gene placement in this record; the host gene section says why.

Coordinates are one-based with both ends included, as each source reports them.

miRBase release 23 places rno-mir-24-2 on Rnor_6.0; NCBI's annotation GCF_036323735.1-RS_2026_08 places the gene Mir24-2 on GRCr8. The two are different assemblies and are not compared here: no liftover is attempted.

The host gene of Mir24-2, from Ensembl's overlap

Ensembl names no rat gene Mir24-2: Ensembl has no rat record for that identifier

The Mir24-2 gene pageThe locus's own records, the transcripts, the variants and the disease associations, are the gene's and are on that page.

Notes on the gene record of Mir24-2

Ensembl has no rat record for that identifier; Ensembl answered so, and its location and release are absent rather than unread

Gene record and placements, from RGD, NCBI Gene and Ensembl · miRBase v23 (2026-07-29); NCBI Datasets 18.38.0 · read 2026-10-02 ET · NCBI Gene 100314278Data from NCBI, provided as is; NCBI's policies and disclaimers apply.
Hairpin and mature placements, from miRBase · miRBase v23 (2026-07-29), Rnor_6.0 · read 2026-10-02 ET · miRBase MI0000855miRBase release 23; Kozomara A, Birgaoanu M, Griffiths-Jones S. Nucleic Acids Research (2019).
RefSeq records of Mir24-2, from NCBI Datasets · NCBI Datasets 18.38.0; GCF_036323735.1-RS_2026_08 · read 2026-10-02 ET · NR_031828.1NCBI Datasets 18.38.0; annotation GCF_036323735.1-RS_2026_08 (public domain)

Reading NCBI Gene, the nomenclature authority and Ensembl.Still reading. A first read of a microRNA can take a while; this page waits up to 90 seconds for it, and its scripts then bring in the panel, or a line saying what did not arrive.

03 In other species

The same arm in mouse, rat and human

Human hsa-miR-24-2-5p (MIR24-2, by the Alliance); mouse: no vote names an ortholog (the Alliance and NCBI answered and named none; Ensembl Compara: no Ensembl gene id is known for Mir24-2, so Compara was not asked; RGD did not answer (upstream error, reference d9a5faa9-28d)). The same-arm sequences share 20 of 22 compared positions with human.

Alliance · NCBI · miRBase

Ready in a moment

04 Cross-references

The sequence at RNAcentral and its member databases

Listed by 3 member databases at RNAcentral (URS00001C4513) for rat. RNAcentral's copy of the sequence is miRBase release 23's.

RNAcentral

Reading RNAcentral.Still reading. A first read of a microRNA can take a while; this page waits up to 60 seconds for it, and its scripts then bring in this line, or a line saying what did not arrive.

Ready in a moment

05 Pathways

Where Reactome places rno-miR-24-2-5p

Reactome v97 maps no pathway to rno-miR-24-2-5p (MIMAT0005441) or to rno-mir-24-2 (MI0000855) in rat.

Reactome

Ready in a moment

06 Targets

Where the target databases are

Predicted and validated targets are held by databases whose terms do not grant display on a company's website; 6 doors open them for rno-miR-24-2-5p.

Reading RNAcentral and the ortholog votes, for the doors.Still reading. A first read of a microRNA can take a while; this page waits up to 120 seconds for it, and its scripts then bring in this line, or a line saying what did not arrive.

Ready in a moment

07 Literature

Papers that mention rno-miR-24-2-5p or its base name miR-24-2

960 PubMed-indexed papers match the query for rno-miR-24-2-5p or its base name miR-24-2 at Europe PMC, 25 a page.

Europe PMC

Ready in a moment

08 AUM BioTech's studies on this microRNA

AUM BioTech's published work on rno-miR-24-2-5p

No checked AUM BioTech record names rno-miR-24-2-5p in rat.

Ready in a moment

09 Inhibit or mimic this microRNA

Targeting rno-miR-24-2-5p

The order page opens with rno-miR-24-2-5p and rat filled in, with AUMantagomir sdASO and AUMmimic sdASO side by side and the price on that page. Five decisions are yours before it does. What is written under each is AUM's guidance; the timings and the concentrations are in the usage guide below.

01
Choose the arm
The mature named on this page is one arm of its hairpin; the other arm, rno-miR-24-3p, is a different microRNA with its own page. An inhibitor or a mimic is made against one arm, and the order door of this page carries rno-miR-24-2-5p.
02
Inhibit or replace
An AUMantagomir sdASO inhibits the mature microRNA; an AUMmimic sdASO supplies one. Both are self-delivering. AUMantagomir toASO is the transfection-optimised version of AUMantagomir sdASO, a lower-cost option that needs a transfection reagent.
03
Check the species
The sequence is rat's, as miRBase release 23 writes it. Where the orthologs card shows the same arm in another species with another sequence, a design for one species is not a design for the other; where the bases are the same, that is a sequence fact the card states, not a claim about the two.
04
Run the controls
A scramble control of the same chemistry, the positive control the order page offers for the product, untreated cells, and a mock condition wherever a transfection reagent is used. The order page lists the controls beside the product.
05
Read the result at the target level
Inhibiting or supplying a microRNA is read in what it acts on, not in the microRNA alone: the transcripts and the proteins your own experiment names as its targets. The usage guide gives the timing and the concentrations to start from; nothing on this page names a target.

Order for rno-miR-24-2-5p Bring your own sequence The usage guide

AUMantagomir sdASO to inhibit or AUMmimic sdASO to replace, chosen on the next page

For research use only. Not for use in diagnostic or therapeutic procedures.

rno-miR-24-2-5p

The mature, its arm and its hairpin

The mature sequence

The hairpin rno-mir-24-2 MI0000855 108 nt

The gene of rno-mir-24-2 and where it sits

The gene Mir24-2 of the hairpin rno-mir-24-2

Placements, each on the assembly its source names

The host gene of Mir24-2, from Ensembl's overlap

The same arm in mouse, rat and human

The sequence at RNAcentral and its member databases

Where Reactome places rno-miR-24-2-5p

Where the target databases are

Papers that mention rno-miR-24-2-5p or its base name miR-24-2

AUM BioTech's published work on rno-miR-24-2-5p

Targeting rno-miR-24-2-5p

Choose the arm

Inhibit or replace

Check the species

Run the controls

Read the result at the target level

The gene Mir24-2 of the hairpin rno-mir-24-2

Placements, each on the assembly its source names

The host gene of Mir24-2, from Ensembl's overlap

The mature sequence

The hairpin rno-mir-24-2 MI0000855 108 nt