Hensel et al. · Epigenetics and Chromatin · 2018
Episomal HBV persistence within transcribed host nuclear chromatin compartments involves HBx
Hensel Kai O., Cantner Franziska, Bangert Felix, Wirth Stefan, Postberg Jan
The study
What was asked, and what was found
Hensel et al., Epigenetics and Chromatin, 2018 asked where in the nucleus the hepatitis B virus keeps its persistent genome, and what holds it there. Chronic infection rests on a circular viral episome, the covalently closed circular DNA, which survives in the nucleus of the liver cell and serves as the template for every viral RNA. Combining circular chromosome conformation capture with RNA sequencing and chromatin immunoprecipitation sequencing, the study found that both the viral episome and the viral X protein sit preferentially in actively transcribed chromatin domains of the host genome, on a size scale matching topologically associating domains. The X protein expressed on its own, without the rest of the virus, occupied the same kind of transcribed territory.
The functional test of that picture used AUMsilence sdASO from AUM BioTech against the messenger RNA for the X protein. The target sequences were chosen inside a stretch of the X gene that does not overlap another viral gene, so any effect could be attributed to the X protein alone. Two separate oligonucleotides and a mixture of the two were given to cycling HepG2.2.15 cells, a human hepatoma line that carries and replicates the virus, by gymnotic delivery, meaning the oligonucleotides were added to the cells with no transfection reagent. Concentrations of 500 nM, 2.5 μM and 5 μM gave very similar results, and since the two higher ones raised the number of dead cells slightly, the reported results were calculated from the 500 nM experiments. A scrambled control oligonucleotide of the same chemistry, sequence TGACCCTATGCTGTTCCTATA, was run in parallel and used to normalise.
Viral episomes were counted by quantitative PCR at 0, 24, 48 and 72 hours, normalised against a human genomic amplicon from the NOS3 promoter. Under every treatment condition the episome level dropped markedly from 48 hours onward. The authors read this as evidence that the episome's persistence in the nucleus depends on the X protein continuing to be expressed, which is the observation their model of viral nuclear localisation rests on.
Key findings
- Silencing the virus's own X messenger RNA with AUMsilence sdASO made the hepatitis B episome less stable in the nucleus, which is the functional test the paper's model rests on.(Abstract, Results)
- Viral episome levels fell from 48 hours onward under every treatment condition, with two separate oligonucleotides and with a mixture of the two.(Results, Knock down of native HBx expression weakens the episomal stability of HBV cccDNA in cycling HepG2.2.15 cells; Figure 4c)
- The oligonucleotides reached the hepatoma cells by being added to the culture with no transfection reagent, and 500 nM was enough, with the higher concentrations bringing no extra effect and slightly more cell death.(Methods, HBx-mRNA silencing)
- The target sequences were picked inside a stretch of the X gene that does not overlap another viral gene, so the knockdown could be attributed to the X protein alone.(Methods, HBx-mRNA silencing)
For research use only. Not for use in diagnostic or therapeutic procedures.